Isolation and molecular characterization of Glyphosate resistant bacteria from agricultural soils in Kerala

Scientific Study , 2016 , 68 Pages , Grade: 1.5

Agrarian Studies

Glyphosate (N-phosphonomethylglycine) is a herbicide that is used worldwidely. Its common trade name is Roundup. Its non-targeted species action makes it most popular herbicide. It was developed by Monsanto company. The primary target for glyphosate is the enzyme EPSPS (5-enolpyruvoylshikimate 3-phosphate synthase). When glyphosate binds to EPSPS it forms a very stable complex that essentially permanently disables the enzyme and hence affect the metabolic activity of the plant and results in its death. Finding Glyphosate degrading microorganisms from soil is an interesting topic since glyphosate is non- targeted in its toxicity. Microorganisms were isolated from soil samples, which were then identified by molecular method. Isolation of DNA, its amplification using 16s rRNA gene and its sequencing are the major steps involved. Bioinformatics tool helps to identify the microorganisms. Two microorganisms identified are Pseudomonas sp. and Achromobacter sp. In the phylogenetic analysis also the two organisms are grouped as separate clads. In these, strain 1 showed highest growth in the Glyphosate containing medium than strain 2. These results show that the bacterial strain may possess potential to be used in bioremediation of glyphosate-contaminated environments.

Table of contents

Table of figures

Table of tables

List of abbreviations

Isolation and molecular characterization of Glyphosate resistant bacteria from agricultural soils in Kerala

Abstract

1. Introduction
1.1 Objectives
1.2 Scope of the study

2. Review of literature

3. Hypothesis

4. Materials and Methods
4.1 Study area
4.2 Soil sample collection
4.3 Isolation of microorganisms from soil
4.4 Morphological and biochemical tests
4.5 Molecular identification and isolation of DNA
4.6 Quantification of DNA
4.7 Agarose gel electrophoresis
4.8 PCR amplification using 16s rRNA
4.9 Data sequencing
4.10 Data analysis
4.11 Glyphosate degradation
4.12 Comparitive study for Glyphosate tolerance
4.13 Statistical analysis

5. Results and discussion
5.1 Isolation of microorganism from soil
5.2 Pure culture preparation, morphological and biochemical identification
5.3 Bacterial DNA isolation
5.4 PCR qmplification using 16s rRNA and sequencing
5.5 Sequence analysis
5.6 Molecular phylogentic analysis using maximum likelihood method
5.7 Evaluation of Glyphosate degredation capacity
5.8 Evaluation of Glyphosate tolerence capacity

6. Conclusions

Acknowledgements

References

ACKNOWLEDGEMENTS

Firstly we thank God Almighty whose blessing were always with us and helped us to complete this project work successfully.

We wish to thank our beloved Manager Rev. Fr. Dr. George Njarakunnel, Respected Principal Dr. Joseph V.J, Vice Principal Fr. Joseph Allencheril, Bursar Shaji Augustine and the Management for providing all the necessary facilities in carrying out the study. We express our sincere thanks to Mr. Binoy A Mulanthra (lab in charge, Department of Biotechnology) for the support. This research work will not be possible with the co- operation of many farmers.

We are gratefully indebted to our teachers, parents, siblings and friends who were there always for helping us in this project.

Prem Jose Vazhacharickal*, Sajeshkumar N.K, Jiby John Mathew and C K Anjana

*Address for correspondence

Assistant Professor

Department of Biotechnology

Mar Augusthinose College

Ramapuram-686576

Kerala, India

[e-mail]

Table of figures

Figure 1. Relationship between pesticide and microbial communites; process and steps of bioremediation; Courtsey: www.intehopen.com )

Figure 2. Flow chart for Glyphosphate degradation pathway; Adapted from: Kryuchkova et al., 2014)

Figure 3. Mean monthly rainfall (mm), maximum and minimum temperatures (°C) in Kerala, India (1871-2005; Krishnakumar et al., 2009)

Figure 4. Map of Kerala showing the various sample collection points; pineapple farm (S1) and tapioca farm (S2)

Figure 5. Ananas comosus details a) pineapple on its parent plant, b) pineapple and its cross section, c) pineapple flower, d) pineapple in the starting stage, e) tropical gold variety, f) victoria variety. Photo courtesy: Wikipedia

Figure 6. Manihot esculenta details a) mature cassava plants, b) cassava plants in early stages, c) cassava roots, d) cooked cassava dish, e) coloured tapioca sticks, f) opaue pearl tapioca. Photo courtesy: Wikipedia

Figure 7. Samples description and growth on media a) soil sample 1, b) soil sample 2, c) first inoculation of sample 1 soil, d) first inoculation of sample 2 soil, e) second inoculation of sample 1, e) second inoculation of sample 2

Figure 8. Bacterial growth on various culture media a) spread plate of strain 1, b) spread plate of strain 2, c) streak plate of strain 1, d) streak plate of strain 2, e) strain 1 on Manitol salt agar, f) strain 2 on Manitol salt agar

Figure 9. Various biochemical tests, a) urease test, b) indole production test, c) MR test, d) VP test, e) citrate test

Figure 10. DNA isolation form bacteria, a) strain 1 DNA, b) strain 2 DNA, c) PCR amplified DNA

Figure 11. Edited sequences of strain 1 strain 2

Figure 12. Graphical representation of BLAST of strain 1

Figure 13. Table view of BLAST results of strain 1

Figure 14. Graphical representation of BLAST of strain 2

Figure 15. Table view of BLAST results of strain 2

Figure 16. Phylogentic tree by maximum likelihood method

Figure 17. Pesticide tolerating capacity of bacteria, a) and b) stain 1 and 2 in 100µl/ml, c) and d) stain 1 and 2 in 300µl/ml, e) and f) stain 1 and 2 in 700µl/ml

Figure 18. Pesticide tolerating capacity of bacteria, a) and b) stain 1 and 2 in 900µl/ml, c) and d) stain 1 and 2 in 1000µl/ml, e) and f) stain 1 and 2 in 2000µl/ml

Table of tables

Table 1. Description of the sample collection sites in Kerala, India

Table 2. Different vernacular names of Ananas comosus around the globe and India.

Table 3. Different vernacular names of Manihot esculenta around the globe and India

Table 4. Morphological and biochemical characterization of the isolated bacteria (strain 1 and 2)

List of abbreviations

illustration not visible in this excerpt

Isolation and molecular characterization of Glyphosate resistant bacteria from agricultural soils in Kerala

Prem Jose Vazhacharickal¹ *, Sajeshkumar N.K¹, Jiby John Mathew¹ and C K Anjana¹

* premjosev@gmailcom

¹ Department of Biotechnology, Mar Augusthinose College, Ramapuram, Kerala, India-686576

Abstract

Glyphosate (N-phosphonomethylglycine) is a herbicide that is used worldwidely. Its common trade name is Roundup. Its non-targeted species action makes it most popular herbicide. It was developed by Monsanto company. The primary target for glyphosate is the enzyme EPSPS (5-enolpyruvoylshikimate 3-phosphate synthase). When glyphosate binds to EPSPS it forms a very stable complex that essentially permanently disables the enzyme and hence affect the metabolic activity of the plant and results in its death. Finding Glyphosate degrading microorganisms from soil is an interesting topic since glyphosate is non- targeted in its toxicity. Microorganisms were isolated from soil samples, which were then identified by molecular method. Isolation of DNA, its amplification using 16s rRNA gene and its sequencing are the major steps involved. Bioinformatics tool helps to identify the microorganisms. Two microorganisms identified are Pseudomonas sp. and Achromobacter sp. In the phylogenetic analysis also the two organisms are grouped as separate clads. In these, strain 1 showed highest growth in the Glyphosate containing medium than strain 2. These results show that the bacterial strain may possess potential to be used in bioremediation of glyphosate-contaminated environments.

Keywords: Glyphosate; BLAST; Pseudomonas; PCR; Roundup.

1. Introduction

Air, water, soil the resources of earth is getting polluted by the activities of man (Nriagu, 1990; Fitzgerald et al., 1998; Duruibeet al., 2007; Singh and Steinnes, 1994). The world is running out of resources and the quality of life of earth is related to the quality of the environment (Lomborg, 2003; Porter, 1995; Rogner, 1997; Zhan, 1992; Albrecht and Devlieger, 1999). The resources in the world now show our negligence or carelessness in lesser or greater degree (Vidali, 2001). A vast amount of pollutants and waste materials including heavy metals are released into the natural environment per annum (Nriagu, 1990; Fitzgerald et al., 1998; Duruibeet al., 2007; Singh and Steinnes, 1994). In a year approximately 6 × 106 chemicals are produced which includes about 1000 new synthetics. Almost 60,000 to 95,000 chemicals are in commercial use. More than one billion pounds (450 million kg) of toxins are released globally in air and water according to the reports of Third World Network (Hussaini et al., 2013). The problem is worldwide and the hazards caused by the contaminants depend upon various factors like the type of contaminant, chemical species, spacial distribution, the concentration and the route of exposure (Malik, 2006; Nriagu, 1990; Fitzgerald et al., 1998; Duruibeet al., 2007; Singh and Steinnes, 1994).

One of such chemical that affect the environment is the pesticide. Pesticides can be defined as substances which are used to control destructive pests like insects, organisms causing plant diseases, weeds, and other organisms like nematodes, arthropods, vertebrates that endanger our food supply, health or comfort. It can also be referred as chemical substances that alter biological processes of living organisms deemed to be pests, whether these are insects, mould or fungi, weeds or noxious plants (Hussaini et al., 2013). These chemicals are found to be very effective in eradicating various pests which destroy agricultural crops, damage stored products, transmit diseases and affect human health. Pesticides help to increase agricultural yield (Pimentel et al., 1993; Sattler et al., 2007; Fernandez- Cornejo et al., 1998; Hillocks, 2012).

The importance of pesticides in India can be understood from the fact that the agriculture is an important component in the Indian economy (Kumar et al., 2010; Gupta, 2004; Abhilash and Singh, 2009; Chand and Birthal, 1997). The increase in the demand for food due to the increase in the human population has led humans to search for efficient methods for increasing agricultural products. Weed control is such a method (Sharifi, 2015). Pesticide usage shows a great impact. But the fact that it is a pollutant cannot be neglected over its advantages. According to the report of World Health Organization (WHO) it is estimated that there are about 3,000,000 cases of pesticide poisonings occurring annually, which leads death of 200,000 approximately. Many of these cases are due to accidental or deliberate intoxication with neurotoxic organophosphate pesticides (Eddleston et al., 2008). The current and future generations are posed with a great threat due to the uptake and accumulation of the toxic substances in the food and drinking water which is caused by the accumulation of toxic compounds in the environment by the excessive use of pesticides (Olawale et al ., 2011).

Some people die every year as a result of pesticide poisoning. In 1956, about 152 deaths were caused in United States as a result ofinsecticide poisoning which also include 94 children below 9 year old (Olawale et al., 2011). In 1969, a family has been poisoned by organic mercury which was present in seed grains fed to hogs that the family had slaughtered for food in New York (Curdley et al., 1991).Two persons in Ekiti state and 5 people in Osun state all in Nigeria were killed by pesticide poison present in grains they used to prepare their food which occurred in 2009 (Olawale et al., 2011).

The increased use of pesticides results in increased human poisonings (Kumar et al., 2010). Potential contamination of surface and ground water is a result of mixing, loading, storage and rinsing of pesticides in the soil (Moormann et al., 1998). The pesticide application may cause adverse effects on different forms of life and ecosystem and this will depend on the sensibility of microorganism and the pesticide. Many of the agricultural pesticide do not reach its target organism; instead they get dispersed through air, water and soil (Gamón et al., 2003). The inadequate application practices results in the pollution not only to the applied area but also the places near to it. Endosulfan disaster occurred in Kasargod of Kerala in India is well known to everyone. It is considered as the worst tragedy that can happen by applying pesticide that affects the region and people (Adithya, 2009). Endosulfan is an organochlorine pesticide under Cyclodiene subgroup. It is highly toxic and can be fatal if inhaled, swallowed or absorbed through the skin (Harikrishnan and Usha, 2004). Pesticides sweeps into the soil and cause toxic effects on arthropods, bacteria, fungi, earthworms and protozoa (Hussaini et al., 2013). Pesticides and their byproducts accumulate on the topmost soil and it influences the population of different soil microbes and their biochemical activities (Agnihotri, 1981). Due to the presence of a wide range of pesticides a single method for its removal is difficult (Nourouzi et al., 2011). The solution for all these problems can be said in two options, prevention or cure. Since prevention is better than cure the former should be practiced well (Malik, 2006). Biological decontamination is better than conventional methods since microorganisms can degrade this chemicals without producing much toxic intermediates (Pieper and Reineke, 2000; Furukawa, 2003). Bioremediation is the process of removal of toxic waste from the environment using biological agents. Biological agents like microorganisms e.g., yeast, fungi and bacteria used in the bioremediation process. In early 1980s, the scientists coined the term Bioremediation to describe the use of microorganisms to clean polluted water and soil. Bio defines the process as biological that is., it is carried out living organisms and remediation defines the process that result in cleaning of the environment, via complete degradation, sequestration, or removal of the toxic pollutants as the result of microbial activity. Degradation means that the microorganisms decompose the pollutants to harmless natural products such as carbon dioxide (CO2), water (H2O), or other nontoxic naturally occurring compounds. Sequestration means that the pollutant is trapped or changed in a way that makes it nontoxic or unavailable to biological systems. Removal means that while the pollutant is not necessarily degraded, the microbes physically remove it from the soil or water so that it can be collected and disposed of safely. Thus Bioremediation can define as the process of using specific microorganisms to transform hazardous components in the soil and water to non-hazardous components (Malik, 2006). Another definition for bioremediation is that it is the process of using microorganisms (bacteria, fungi), green plants or their enzymes to return the natural environment altered by contaminants of original condition. This process can be employed to attack specific soil contaminants, such as degradation of chlorinated hydrocarbons by bacteria. An example is the use of superbug to clean the oil spills (Radhika et al., 2014). The organisms may be present within the region or maybe isolated from different site and introduced to the contaminated region. Through metabolic process the microorganism will transform the contaminant. Often multiple organisms are involved in the biodegradation of a compound. The process of importing microorganisms into the contaminated area to enhance degradation is called Bio augmentation (Vidali, 2001).

According to University of Free State, bioremediation can be used to stabilize, extract or reduce the toxicity of contaminated soil and groundwater. It is a technology that have a huge role in a country with very little water source, rapidly expanding population, extensive mineral resources with management problems. It is a simple and robust technology that can be applied to a broad range of contaminants. The substantial metabolic capacities of the microorganisms are used in the biological treatments to convert the pollutants to harmless, at least less dangerous compounds. Several studies were initiated to isolate such microorganisms that have the ability to degrade pollutants (Nourouzi et al., 2011). Major breakthrough in the recent years in this topic have enabled detailed study on genomic, metagenomic, proteomic, bioinformatics and other high-throughput analyses of environmentally relevant microorganisms providing unprecedented insights into key biodegradative pathways and the ability of organisms to adapt to changing environmental conditions (Hussaini et al., 2013).

Like other technologies, bioremediation also have its own limitation. One of such limitation is that, some pollutants are resistant to degradation by microorganisms. They maybe degraded slowly or sometimes not at all. So there are no rules for remediation (Vidali, 2001).

Glyphosate, broad spectrum and non-selective systemic herbicide can be described by its stable, covalent carbon to phosphorus bond (COP). The demand for glyphosate in the world has been increased substantially. According to the report of Ho (2008), glyphosate usage has increased 15 folds on major crops from1994 to 2005. Glyphosate itself is an acid, but it is commonly used in form of salt, most commonly the isopropylamine (solubility 12g/L) salt (Nourouzi et al., 2011).

The WHO’s cancer authorities- the International Agency for Research on Cancer (IARC) recently determined that Glyphosate is “probably carcinogenic to humans”. Epidemiological studies showed higher rates of cancer in farmers using glyphosate and researches show that glyphosate damages DNA and chromosomes, one mechanism by which cancer is induced (Guyton et al., 2015). Most testings are done on the main component Glyphosate in the formulations (e.g., Roundup) used in the real world, but the toxicity is beyond because of the undisclosed ingredients. Herbicide exposure is also linked to increased rates of Parkinson’s disease (Brighina et al., 2008).

Genetically modified (GM) crops resistant to Glyphosate also give a sign of danger. All animals and humans consuming the GM feed (soybean, corn) incorporate an unknown amount of herbicide. Residues of glyphosate in tissues and organs of animals are not considered or neglected (Kruger et al., 2014). So studies should be seriously done to avoid the worst situation that need to be faced in future. The objective of this study is to isolate and identify the bacteria that can degrade the Glyphosate herbicide.

1.1 Objectives

The objectives of this research work are to identify the microorganisms that are resistant to the pesticide containing Glyphosate (Roundup) using molecular method. From these organisms the ability of it to degrade the glyphosate can also be identified by growing the organism in special media which contain glyphosate as the only phosphorus source. Plymerase chain reaction (PCR) amplification of DNA of the organism is done using the primer made from 16s rRNA to identify the organism.

1) To identify the microorganisms those are resistant to Glyphosate.
2) To check the glyphosate degrading capacity of the microorganisms.

1.2 Scope of the study

The current research work aims to isolate and charaterze Glyphosate resistant bacteria from agricultural soils in Kerala which be further explored to effective bioremediation in agriculture soils.

2. Review of literature

Soil is rich in microflora. The use of pesticides in the fields and crops become a regular practice and hence an environmental concern. This results in the hazardous effects of these chemicals in the fields especially the biological processes in the soil and also the pollution causing through its runoff (Moneke et al., 2010; Yonghua et al., 2000; Singh, 2008; Fang and Qiu, 2002).

Pesticides can be classified into different types based on its chemical nature, structure, pesticide function etc.Herbicide is such a type.Herbicides are used to kill weeds i.e., it is a pesticide used to kill unwanted plants.Most commonly used herbicides include Roundup (isopropylamine salt of glyphosate), 2, 4- dichlorophenoxyacetic acid (2, 4-D) etc. Glyphosate on its own may be relatively harmless to humans (Moneke et al., 2010). According to Franz et al. (1997), Organophosphates, including glyphosate, account for half of the pesticides used worldwide with glyphosate based formulations such as RoundupR, AccordR and TouchdownR consisting the commonest types used for agricultural purposes (Franz et al., 1997).

Glyphosate (N-phosphonomethylglycine) is a broad spectrum, post emergence, nonselective herbicide used in the control and/or killing of grasses, herbaceous plants, including deep rooted perennial weeds, brush, some broad leaf trees and some shrubs (USDA, 2000; Cox, 2000).It can be used to clear the lands in no till agriculture, and also before and after harvest (Moneke et al., 2010).

Glyphosate was discovered by Monsanto and they held its patent for many years. Now it’s being produced by many companies in different trade names.Some of the current trade names include: Roundup Ultra®, Roundup Pro®, Accord®, Honcho®,Pondmaster®, Protocol®, Rascal®, Expedite®, Ranger®, Bronco®, Campain®, Landmaster®, and Fallow Master® by Monsanto; Glyphomax® and Glypro® by Dow AgroSciences; Glyphosate herbicide by Du Pont; Silhouette® by Cenex/Land O’Lakes; Rattler® by Helena; MirageR® byPlatte; JuryR® by Riverside/Terra; and Touchdown® by Zeneca. As of November 2001, Rodeo®(previously manufactured by Monsanto) is now being manufactured by Dow AgroSciences andMonsanto is now producing Aquamaster® (Tu et al., 2001). In terrestrial plants, it is usually sprayed in the foliage, green stems and cut stems but it cannot penetrate woody barks (Carlisle and Trevors., 1988). And for aquatic use only certain formulations are registered (e.g., Rodeo®) as glyphosate itself is non- toxic to submerged plants (Forney and Davis 1981), but the adjuvants along with can be toxic (Tu et al., 2001).

Mode of action of glyphosate is like, it inhibits the enzyme 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) which functions in the shikimate pathway that results in the depletion of essential aromatic amino acids like tyrosine, tryptophan, phenylalanine that is needed for plant survival (Moneke et al., 2010). EPSPS is a chloroplast -localized enzyme which is involved in the shikimate pathway of plants (Della-Cioppa et al., 1986). Inhibition of EPSPS prevents the production of chorismate which is required for the essential aromatic amino acid production. These amino acids are necessary for plants for protein synthesis and for the production of several secondary plant products like growth promoters, growth regulators, phenolics, lignin etc. (Franz et al., 1997). Since EPSPs are present in the chloroplast of most plants, glyphosate herbicide may not affect animals. Animals obtain these amino acids by eating plants and other animals (Tu et al., 2001). Glyphosate is also a competitive inhibitor of phosphoenolpyruvate (PEP) which is one of the precursors of aromatic amino acid synthesis. It has effects on other biochemical activities but these are considered as secondary which accounts only in its total lethal actions (Tu et al., 2001).

Using nuclear magnetic resonance spectroscopy, it is been reported that Glyphosate has shown close similarity in its structure to the tetrahedral phosphoenolpyruvoyloxonium ion derivative of PEP formed during the catalytic conversion to S3P, and the adduct formation with EPSPS (Christensen and Schaefer, 1993). Hence it has been proposed that, the inhibitory activity of glyphosate is by the Transition State Analogue (TSA) of the putative phosphoenolpyruvoyloxonium ion derivative of PEP from plants (Anton et al., 1983; Steinrücken and Amrhein, 1984; Kishore and Shah, 1988) and bacteria (Du et al., 2000; Arcuri et al., 2004). The mechanism of inhibition of EPSPS by glyphosate due to TSA has been widely accepted since many evidences been shown in different studies that glyphosate forms a tight ternary complex with EPSPS (Herman and Weaver, 1999). But different from natural competitive binding of inhibitor, Monsanto biochemist researchers evidenced that Glyphosatewas an inhibitor to EPSP but uncompetatively (Sammons et al., 1995; Schönbrunn et al., 2001; Alibhai and Stallings, 2001; Funke et al., 2006).

In the studies of Cox (2000) and Santillo et al. (1989), although most living organisms lack this metabolic route such that they would not be potentially affected by this herbicide, the environmental consequences of the widespread use of glyphosate have been reported (Cox, 2000; Santillo et al., 1989). Glyphosate is adsorbed by clay and organic matter like humus and hence remain unchanged in the soil for a long time (Penaloza-Vazque et al., 1995). It may also form complexes with metal cations; Fe² +, Cu² +, Mn² +, Ni² + (Kremer et al., 2005).

Degradation of glyphosate from the soil is by microbial process rather than chemical process because of the presence of highly stable bonds i.e., Carbon-phosphorus bond present in the compound (Moneke et al., 2010). Glyphosate has found to be degraded in both soil and water. It has a reported field half-life of 47 days and a laboratory half-life of <25 days (Ahrens, 1994). Glyphosate is stable to sunlight, relatively non-leachable, and has a low tendency to runoff. Because of its strong adsorption to soil particle, it is relatively immobile in soil environment (Schuette, 1998). Study of Ghassemi et al. (1981) showed that less than one percent of glyphosate is absorbed by plant roots.

Bacteria and fungi are the primary decomposers of Glyphosate in the soil. Soil type, climatic conditions, glyphosate bioavailability etc. are some factors that determine the degradation rate of glyphosate. The primary metabolite of glyphosate is aminomethylphosphonic acid (AMPA) and carbon dioxide. AMPA may get adsorbed to soil particles more firmly or it may less likely to be permeate the cell walls or membranes of soil microorganisms which makes the degradation of AMPA much slower than glyphosate (USDA, 1984). Glyphosate and AMPA can be characterized by the firm C-P bond, which is resistant to the chemical-physical factors but ruptures when acted on by microbial enzyme systems (Ternan et al., 1998). In the presence of manganese peroxide (MnO) the C-P bond of glyphosate can be broken non- enzymatically but this type of degradation cannot be seen commonly (Barrett and McBride, 2005). The C-P bond can also be broken by lignolytic enzymes of soil microflora (Pizzul et al., 2009). Glyphosate oxidoreductase (GOX) enzyme degrades the C-N bond of the glyphosate to produce AMPA and glyoxylate. For the degradation of glyphosate and AMPA, microbes must have C-P lyase. Sarcosine is another product of degradation of glyphosate by C-P lyase but it is not deeply studied.

Examples for microbes in the soil having C-P lyase are Pseudomonas sp., Rhizobium sp. and Streptomyces sp. and microbes having GOX are Arthrobacter atrocyaneus and Pseudomonas sp. C-P lyase can utilize glyphosate as the sole source of phosphorus. GOX can degrade glyphosate to AMPA in which C-P lyase can further act on it and degrade it. But this step is slower comparing to the step of formation of AMPA.

To control annual and perennial plants on various crops, orchards, plantations, pastures, lawns, gardens, forestry, roadsides and aquatic weeds glyphosate is being used (Watts and Macfarlane, 1999). And since commercialism of crops, they were been genetically modified (GM) to be glyphosate tolerant, the herbicide is used to control weeds during crop growing seasons. Currently Glyphosate resistant (GP) crops include soyabean, maize, canola, sugar beet and alfalfa (James, 2011). For the production of GM crops of canola, GOX gene were taken from Ochrobactrum anthropi (Green, 2009). The strategy used in GP tolerant crops is the expression of mutated form of EPSPS or wild type EPSPS (Cp4 EPSPS) that is not inhibited by GP. An enzyme called GOX can chemically breakdown glyphosate into AMPA and glyoxlate.

In GP resistant crops, GOX is also used along with Cp4 EPSPS to enhance the resistant property so that wild type EPSPS can tolerate glyphosate and GOX can degrade glyphosate. The Cp4 EPSPS is naturally less sensitive to inhibition by glyphosate in several crops. GOX protein breaks the glyphosate into non-toxic compounds, which is a second mechanism for glyphosate tolerance in Roundup Ready crops (Padgette et al., 1996). One attempt to produce GP resistant crops was to use transgenes which is isolated from glyphosate resistant microorganisms. Gox gene was isolated from the bacteria since C-P lyase enzyme isolation was too difficult. Glycine Oxidase is another enzyme used but in mutated form since it show sequence similarity to GOX enzyme. Recently an enzyme called glyphosate decarboxylase from a fungus has been patented for this purpose.

16s rRNA is a conserved region in all organisms. So for the identification of microorganisms, primer made from 16s rRNA can be used. And this will amplify the DNA which can then be used for sequencing. The sequence of forward primer is 5’ AGAGTTTGATCCTGGCTCAG 3’ and reverse primer is 5’ ACGGCTACCTTGTTACGACTT 3’. Melting temperature for F primer is 61.0°C and R primer is 61.5°C. GC% are 50 and 47.6 respectively.

According to the statement of Monsanto Company, Glyphosate will not affect animals. But because of the lethal effects showed by glyphosate in animals, Glyphosate has been listed as ‘unlikely to present an acute hazard in normal use’ by WHO and US EPA ranks glyphosate in toxicity category “caution”. And some other formulations categorize it under ‘danger’ or ‘warning’ list for primary eye irritation and skin irritation. Surfactant in glyphosate POEA (polyethoxylated tallow amine) reported severe poisoning effects such as eye irritation, respiratory problems, lung tissue damage and other injuries. Other symptoms are vomiting, diarrhea, hemolysis of red blood cells, hypotension, altered mental status and pulmonary edema; ingestion can cause in addition pharyngitis, abdominal pain, liver and renal damage, erosions of the esophagus, oropharynx and stomach (Sullivan and Krieger, 2001). Repeated spraying of glyphosate formulations reported eye, skin and respiratory problems, nausea, dizziness, vomiting, as well as accelerated heart beat, increased blood pressure and allergies (Nivia-Rapalmira, 2001). Research findings show that glyphosate and its formulations cause cancer, affect embryo development, damage DNA and cells, and could interrupt the hormone systems.

Soil microbial structural and functional diversity can be altered by the glyphosate utilization. And in some cases it may affect the agricultural production (Yu et al., 2015). Acoording to Romero et al. (2011), glyphosate and glyphosate containing herbicides on soil microbial ecosystems and agriculture, it is important to identify methods for glyphosate degradation and biological remediation in soil. Biodegradation, photo degradation, oxidation, flocculation and filtration, adsorption and membrane techniques are some of the methods for its removal. But glyphosate is resistant to chemical, hydrolytic and photolytic degradation. Hence development of a cheap and environmental friendly bioremediation method using glyphosate degrading microorganism will be a good and promising approach for cleaning and restoring soil contaminated with this herbicide.

Complex natural compounds like lignin and humic material are degraded by bacteria through different mechanisms. There are certain chemicals that were absent or rare in the environment like pesticides or industrial chemicals that are released into the environment which affect the soil microflora (Alexander, 1985). But gradually some microorganisms get adapted to the situation and become resistant to it. Isolation and characterization of such microorganisms helps in identification of strains that could attack persistent pollutant more aggressively since these organisms will have genes encoding catabolic pathways and that are usually plasmid borne (Chaudhry and Chapalamuguda, 1991). Many studies have shown that glyphosate can be degraded by microorganisms and plants. The most active type of microorganisms that degrade glyphosate was isolated from soil that was polluted by organophosphate herbicides (Shushkova et al., 2010). These organisms utilize glyphosate as carbon source or phosphorus source. Utilization of carbon source produces aminomethylphosphonic acid and phosphorus source produce glycine (Solomon et al., 2007). The most versatile and diversified organisms with regard to their nutritional requirements are bacteria’s (Leckie, 2005).

The identification of such microorganisms can be done by molecular method and morphological method. In morphological studies, gram staining, motility test, catalase test, urease test etc. are done to identify the microorganism. In molecular method, DNA of the bacteria is isolated. The PCR can be used to amplify the DNA and this DNA is then used for sequencing to identify the microorganism. According to Integrated DNA technologies, the polymerase chain reaction is arguably the most powerful laboratory technique ever invented. The easy use, relatively low cost, and its unique combination of specificity and sensitivity coupled with great flexibility led to a true revolution in genetics. It was conceptualized and operationalized by Kary Mullis and colleagues at Cetus Corporation in the early 1980’s (Saiki et al., 1985).

After PCR agarose gel electrophoresis is done. Agarose gel electrophoresis is a widely used procedure in various areas of biotechnology. It is a powerful separation method frequently used to analyze DNA fragments and is a convenient analytical method for determining the size of DNA molecules.

Bioinformatics tool can be used to identify the microorganism. According to NCBI (2001), bioinformatics is the field of science in which biology, computer science and information technology merges into a single discipline. Basic Local Alignment Search Tool (BLAST) is the most commonly used sequence alignment tool which was developed Altschul et al. (1990). BLAST will compare the unknown sequence with other known sequences in the database to identify the similar sequence. Hence the microorganism can be identified by molecular method.

3. Hypothesis

The current research work is based on the following hypothesis

1) Glyphosate resistant bacteria could be seen in agricultural farms in Kerala and vary with type of farming practices
2) Glyphosate resistant bacteria could able to use Glyphosate as a source of phosphorous
3) Glyphosate degaration capacity among resistant bacteria vary due to their gentic and metabolic capabilities

4. Materials and Methods

4.1 Study area

Kerala state covers an area of 38,863 km² with a population density of 859 per km² and spread across 14 districts. The climate is characterized by tropical wet and dry with average annual rainfall amounts to 2,817 ± 406 mm and mean annual temperature is 26.8°C (averages from 1871-2005; Krishnakumar et al ., 2009). Maximum rainfall occurs from June to September mainly due to South West Monsoon and temperatures are highest in May and November (Figure 1).

4.2 Soil sample collection

Soil samples were collected from two regions which were treated with Roundup pesticide for several years. One was from Ananas comosus (pineapple) farm and the other was from region of Manihot esculenta (tapioca farm). Sample 1 was from pineapple farm; soil is moisturized and the region is near to a lake. Sample 2 was from tapioca farming region; soil is much drier and a pond is near to it.

4.3 Isolation of microorganisms from soil

The soil used for the enrichment and isolation of pesticide tolerantbacteria was obtained. 1gm of soil sample was put into a 150ml flask containing 30ml of sterile liquid Mineral Salt Medium (MSM) with10 microliter of glyphosate diluted in 1ml of distilled water. All the above flasks were incubated at 28 ± 2°C for 7days on static conditions (1st enrichment). From every flask, 5ml was re-inoculated to the flask with same medium composition aseptically and further incubated at 28 ± 2°C for 7 days on static conditions.

4.3.1 Pure culture preparation

Bacterial pure culture was prepared by streak plate method. One loop full of enrichment culture from the flasks was streaked on minimal salt agar of same concentration in plates supplemented with glyphosate which is also in same concentration. Minimal salt agar can be prepared by adding 15g/L of agar to the media. The growth of the bacterialcolonies was measured after 24-48 hr incubation at 28°C. Morphologically dissimilar colonies were randomly selected and sub cultured onto nutrient medium and maintained at 4°C for bacterial characterization. From the plates two different colonies were identified.

4.4 Morphological and biochemical tests

Identification of the isolates were performed according to their morphological, cultural and biochemical characteristics by following Bergey’s Manual of Systematic Bacteriology (Kandler and Weiss, 1986). All the isolates were subjected to Gram staining and specific biochemical tests.

4.4.1 Gram staining

A clean grease free slide was taken and a smear of the bacterial culture was made on it with a sterile loop. The smear was air-dried and then heat fixed. Then it was subjected to the following staining reagents:

(i) Flooded with Crystal violet for 1 min. followed by washing with running distilled water.
(ii) Again, flooded with Gram’s Iodine for 1 min. followed by washing with running distilled water.
(iii) Then the slide was flooded with Gram’s Decolourizer for 30 seconds.
(iv) After that the slide was counter stained with Safranin for 30 seconds, followed by washing with running distilled water.
(v) The slide was air dried and cell morphology was checked under microscope.

4.4.2 Colony morphology

This was done to determine the morphology of selected strains on the basis of shape, size and color.

4.4.3 Catalase test

The catalase test was performed to detect the presence of catalase enzyme by inoculating a loopful of culture into a drop of 3% of hydrogen peroxide solution taken in a glass slide. Positive test was indicated by formation of effervescence or appearance of bubbles, due to the breaking down of hydrogen peroxide (H2O2) to oxygen (O2) and water (H2O).

4.4.4 Motility test

This test is done to check the motility of the microorganism. The organism was taken in a cavity slide from a 24 hour inoculated broth and observes under the microscope.

4.4.5 Mannitol salt agar test

This experiment is generally performed to determine whether the bacteria are capable of fermenting mannitol sugar or not. Whenever organisms ferment mannitol agar, the pH of media becomes acidic due to production of acids. The fermentation of the media from red to yellow which shows positive test result.

4.4.6 Urease test

Using sterile technique, inoculate a loopful of experimental organism into urea broth tube. Incubate the tube for 24 to 48 hours at 37°C and then observe the color change.

4.4.7 IMViC test

(i) Indole Test: Indole test is done in sulfide-indole-motility medium (SIM). A loopful of experimental organism is inoculated into SIM medium. Result is read after adding Kovac’s reagent.
(ii) Methyl Red Test: MR test is done in Methyl-Red-Voges-Proskauer broth (MR- VP). A loopful of experimental microorganism is inoculated into the medium. Result is checked by adding methyl red.
(iii) Voges-Proskauer Test: VP test is done in MR-VP broth. A loopful of experimental microorganism is inoculated into the medium. Result is checked by adding Barrit’s A and Barrit’s B reagent.

[...]

• College: Mar Augusthinose College
• Grade: 1.5
• Authors: Dr. Prem Jose Vazhacharickal (Author), Sajeshkumar N.K (Author), Jiby John Mathew (Author), C K Anjana (Author)
• Publication Year: 2016
• Pages: 68
• Catalog Number: V355561
• ISBN (eBook): 9783668424487
• ISBN (Book): 9783668424494
• Language: English
• Tags: isolation, glyphosate, kerala